What Is RoMeio?

The RoMeio (Reducing environments & Meiofauna) platform was initiated by scientists participating in the first workshop on "Meiofauna from chemosynthetic deep-sea environments", sponsored by ChEss (Census of Marine Life: Biogeography of Deep-Water Chemosynthetic Ecosystems) held in Ghent, Belgium, June 2010.

The aim of this platform is to provide a forum for the exchange information on meiofauna from chemosynthetic, reducing environments such as hydrothermal vents, cold seeps, whale falls, sunken wood, and areas of low oxygen that intersect with continental margins and seamounts. In order to enhance our knowledge and to stimulate further RoMeio research, the participants have provided information on the currently described species from these environments, on meiofauna taxonomists who can help with species identifications and descriptions, and current DNA extraction protocols. In addition, the current projects and lines of research are provided. Furthermore in order to promote the awareness of meiofauna research to the general public, a collection of pictures and individual outreach initiatives are included on the site.

Workshop Report

List of Members
List of Taxonomists
Contact List of Taxonomists
List of Species

Current/Planned Projects

• Taxonomy
• Biology Of Selected Taxa
• Community Ecology
• Interests of Scientists/Material Searched
• Public Outreach Experience

A List of Members

Excel file of RoMeio Members

Last Name	First Name	University/Institution	Country	E-mail Address
Adão	Helena	University of Évora	Portugal	hadao@uevora.pt
Barnes	Natalie	Natural History Museum London	U.K.	n.barnes@nhm.ac.uk
Bright	Monika	University of Vienna	Austria	monica.bright@univie.ac.at
De Groote	Annelies	University of Ghent	Belgium	annelies.degroote@ugent.be
Ferrero	Tim	Natural History Museum London	U.K.	t.ferrero@nhm.ac.uk
Gollner	Sabine	DZMB Senckenberg Institute	Germany	sabine_gollner@gmx.at; sabine.gollner@senckenberg.de
Guilini	Katja	University of Ghent	Belgium	katja.guilini@ugent.be
Hwang	Jiang-Shiou	National Taiwan Ocean Universty	Taiwan	jshwang@mail.ntou.edu.tw
Ivanova	Kateryna	University of Algarve	Portugal	katy.iva@gmail.com
Lampadariou	Nikolaos	Hellenic Centre for Marine Research	Greece	nlamp@hcmr.gr
Lee	Mathew Richard	Centro i~mar, Universidad de Los Lagos	Chile	matt@matthewlee.org
Mantha	Gopikrishna	National Taiwan Ocean Universty	Taiwan	jshwang@mail.ntou.edu.tw
Miljutin	Dmitry	DZMB Senckenberg Institute	Germany	Dmitry.Miljutin@senckenberg.de
Miljutin	Maria	DZMB Senckenberg Institute	Germany	mmiljutina@senckenberg.de
Moodley	Leon	NIOZ	Netherlands	l.moodley@nioo.knaw.nl
Ngo	Xuan Quang	Institute of Tropical Biology	Vietnam	ngoxuanq@gmail.com
Paiva dos Santos	Giovanni Amadeu	Federal University of Pernambuco	Brazil	Giopaiva@hotmail.com
Pape	Ellen	University of Ghent	Belgium	Ellen.Pape@Ugent.be
Plum	Christoph	University of Oldenburg	Germany	mmiljutina@senckenberg.de
Portnova	Daria	Inst. of Oceanology P.P. Shirshov Moscow	Russia	daria.portnova@gmail.com
Sharma	Jyotsna	University of Texas	USA	jyotsna.sharma@UTSA.edu
Tchesunov	Alexei V	Lomonosov's Moscow State University	Russia	AVTchesunov@yandex.ru
Thistle	Dave	Florida State Univerity	USA	dthistle@fsu.edu
Van Campenhout	Jelle	University of Ghent	Belgium	Jelle.Vancampenhout@ugent.be
Vanreusel	Ann	University of Ghent	Belgium	ann.vanreusel@ugent.be

Top
List of Members

A List of Taxonomists

Contact List of Taxonomists

Acari

Anciferova, Maria

Amphipoda

Vinogradov, Egor

Bivalvia

Krylova, Elena

Ciliata

Sergeeva, Nelli

Copepoda

George, Kai (Harpacticoida)

Gollner, Sabine (Dirivultidae)

Huys, Rony (Poecilostomatoida)

Kalogeropoulou, Vassiliki (Harpacticoida)

Mantha, Gopikrishna (Cyclopoida)

Plum, Christoph (Harpacticoida)

Foraminifera

Bernhard, Joan

GKoho, Karoliina

(Moodley, Leon)

Kamenskaya, Olga (Xenophyophorea)

Kinorhyncha

Bright, Monika

Nematoda

Barnes, Natalie

Bezerra, Tania Nara

Ferrero, Tim

Ivanova, Kateryna

Lampadariou, Nikolaos

Miljutina, Maria

Miljutin, Dmitry

Mokievsky, Vadim

Portnova, Daria

Sergeeva, Nelli

Sharma, Jyotsna (Chromadoridae)

Tchesunov, Alexei V. (hydrothermal vent nematodes)

Polychaeta

Nelli, Sergeeva

Tardigrada

Mokievsky, Vadim

Sergeeva, Nelli

Top
List of Taxanomists

Contact List of Taxonomists

List Of Species

Anciferova, Maria

Laboratory of Coastal Ecology, P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, 36, Nakhimovskiy Prospect, 17218 Moscow, Russia, antsmasha@mail.ru

Barnes, Natalie

The Natural History Musuem, Department of Zoology, Cromwell Road, London, SW7 5BD, U.K., n.barnes@nhm.ac.uk

Bernhard, Joan M

Department of Geology & Geophysics, Woods Hole Oceanographic Institution, MS #52 Woods Hole, MA 02543, USA, jbernhard@whoi.edu

Bezerra, Tania Nara

Marine Biology Research Group, Ghent University, Krijgslaan 281/S8, 900 Ghent, Belgium, Tania.CampinasBezerra@UGent.be

Bright, Monika

University of Vienna, Department of Marine Biology, Althanstrasse 14, 1090 Vienna, Austria, monika.bright@univie.ac.at

Ferrero, Tim

The Natural History Musuem, Department of Zoology, Cromwell Road, London, SW7 5BD, U.K., t.ferrero@nhm.ac.uk

George, Kai

Forschungsinstitut Senckenberg, DZMB, Südstrand 44, 26382 Wilhelmshaven, Germany, kgeorge@senckenberg.de

Gollner, Sabine

Forschungsinstitut Senckenberg, DZMB, Südstrand 44, 26382 Wilhelmshaven, Germany, sabine.gollner@senckenberg.de, sabine_gollner@gmx.at

Huys, Rony

Natural History Museum, Department of Zoology, Cromwell Road, London, SW7 5BD, U.K., r.huys@nhm.ac.uk

Ivanova, Kateryna

(1)Faculdade de Ciencias e Tecnologia, Universidade do Algarve, Portugal, (2)Department of Benthos Ecology, Institute of Biology of the Southern Seas, Sevastopol, Ukraine, katy.iva@gmail.com

Kalogeropoulou, Vassiliki

Hellenic Centre for Marine Research, Gournes Pediados, P.O.Box 2214, P.C. 71003, Greece, vkalogeropoulou@her.hcmr.gr

Koho, Karoliina

Faculty of Geosciences, Utrecht University, Budapestlaan 4, 3584 CD Utrecht, The Netherlands, K.Koho@geo.uu.nl

Kamenskaya, Olga

Laboratory of Deep Sea Benthos, P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, 36, Nakhimovskiy Prospect, 117218 Moscow, Russia, okamenskaya@ocean.ru

Krylova, Elena

Laboratory of Deep Sea Benthos, P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, 36, Nakhimovskiy Prospect, 117218 Moscow, Russia elenamkr@mail.ru

Lampadariou, Nikolaos

Hellenic Centre for Marine Research, Gournes Pediados, P.O.Box 2214, P.C. 71003, Greece, nlamp@her.hcmr.gr

Mantha, Gopikrishna

National Taiwan Ocean University, Taiwan, gopipoda@yahoo.com, gkmantha@gmail.com

Miljutin, Dmitry

Forschungsinstitut Senckenberg, DZMB, Südstrand 44, 26382 Wilhelmshaven, Germany, Dmitry.Miljutin@senckenberg.de

Miljutina, Maria

Forschungsinstitut Senckenberg, DZMB, Südstrand 44, 26382 Wilhelmshaven, Germany,; mmiljutina@senckenberg.de

Mokievsky, Vadim

Laboratory of Coastal Ecology, P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, 36, Nakhimovskiy Prospect, 117218 Moscow, Russia, vadim@ocean.ru

Moodley, Leon

Netherlands Institute of Ecology, Korringaweg 7, 4401 NT Yerseke, The Netherlands, l.moodley@nioo.knaw.nl

Plum, Christoph

University of Oldenburg, ICMB, Department for Planktology, Schleusenstrasse 1, 26382 Wilhelmshaven, Germany, christoph.plum@uni-oldenburg.de

Portnova, Daria

Laboratory of Deep Sea Benthos, P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, 36, Nakhimovskiy Prospect, 117218 Moscow, Russia, daria.portnova@gmail.com

Sergeeva, Nelli

Department of Benthos Ecology, Institute of Biology of the Southern Seas, Sevastopol, Ukraine, nserg05@mail.ru

Sharma, Jyotsna

University of Texas San Antonio, Department of Biology, One University Circle, San Antonio, TX 78287, USA, jyotsna.sharma@UTSA.edu

Tchesunov, Alexei V.

Lomonosov's Moscow State University, Uliza Svobody 19/1-26, 125362 Moscow, Russian Federation, AVTchesunov@yandex.ru

Vinogradov, Egor

Laboratory of Deep Sea Benthos, P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences, 36, Nakhimovskiy Prospect, 117218 Moscow, Russia, egor@ocean.ru

Top
Contact List of Taxonomists

List of Species

Current/Planned Projects

For details see Excel file RoMeioSpeciesList

DNA Protocols

Gene: COI

Taxon: Copepoda (Dirivultidae)

Reference: Gollner S, Fontaneto D, Martínez Arbizu P (in press) Molecular taxonomy confirms morphological classification of deep-sea hydrothermal vent copepods (Dirivultidae) and suggests broad physiological tolerance of species and frequent dispersal along ridges. Mar Biol

Short description: DNA was extracted from single specimens in 40μl of chelex (InstaGene Matrix, Bio-Rad). For each individual, partial cytochrome c oxidase subunit I (COI) was PCR-amplified using generic primers LCOI (50-GGT CAA CAA ATC ATA AAG ATA TTG G-30) and HCOI (50-TAA ACT TCA GGG TGA CCA AAA AAT CA-30) (Folmer et al. 1994).Cycle sequencing reactions were set up using PCR primers and the GE Healthcare Illustra Pure Taq PCR beads. The final mix optimized for the PCR contained 0.5 μl LCOI, 0.5 μl HCOI, 20 μl distilled H2O, and 4 μl of the DNA extract. Cycle conditions comprised initial denaturation at 95 °C for 5 min, followed by 40 cycles at 95 °C for 30 sec, 42 °C for 1 min, and 72 °C for 1 min, and a final extension step at 72 °C for 7 min. The PCR was run on a BioRad MyCycler Thermocyler.

Gene: COI

Taxon: Nematoda (Xyalidae)

Reference: Derycke S, Remerie T, Vierstraete A, Backeljau T, Vanfleteren J, Vincx M, Moens T (2005) Mitochondrial DNA variation and cryptic speciation within the free-living marine nematode Pellioditis marina. Mar Ecol Prog Ser 300: 91-103.

Short description: Individual nematodes were transferred to 20 μl WLB (Worm Lysis Buffer). In order to amplify a portion of the cytochrome c oxidase subunit I (COI) gene, the primers JB3 (5'-TTTTTTGGGCATCCTGAGGTTTAT-3') and JB5 (5'-AGCACCTAAACTTAAAACATAATGAAAATG-3') were used (Derycke et al., 2005). The total mix before the PCR was prepared in 10 μl volumes and contained 0.4 μl JB3, 0.4 μl JB5, 0.2 μl dNTP's, 1 μl Taq buffer, 0.2 Taq lab, 1 μl MgCl2, 5.3 μl distilled water and 1.5 μl DNA extract. PCR amplification was conducted for 45 cycles with an initial denaturation step at 95 °C for 5 min, then 30 s denaturation at 94°C, 30 s annealing at 54°C and 30 s extension at 72°C and a final extension step for 5 min at 72°C.

Gene: COI, ITS, D2D3 en COI regions

Taxon: Nematoda

Reference:Derycke S, Remerie T, Vierstraete A, Backeljau T, Vanfleteren J, Vincx M, Moens T (2005) Mitochondrial DNA variation and cryptic speciation within the free-living marine nematode Pellioditis marina. Marine Ecology Progress Series 300: 91-103. Derycke S, Vanaverbeke J, Rigaux A, Backeljau T, Moens T (2010). Exploring the Use of Cytochrome Oxidase c Subunit 1 (COI) for DNA Barcoding of Free-living Marine Nematodes. Plos ONE, accepted.

DNA extraction (Nematoda):

Reagents needed:

• WLB : Worm lysis buffer: 10 ml end volume
• 50 mM KCl: 1ml 500 mM
• 10 mM Tris pH 8.3: 1ml 100 mM
• 2,5 mM MgCl2: 50 µl 0.5 mM
• 0,45 % NP 40 (Tergitol Sigma): 1 ml 4.5%
• 0,45 % Tween 20: 1 ml 4.5
• 60 µg/ml proteinase K: 1 µl (add just before incubation)
• 4.05 ml in total -> add 5.95 ml bidi (end volume of 10 ml)

Make the 10 ml sterile by pushing it through a 0.2µm filter and distribute it over several sterile eppendorfs (of 1.5ml). Store at –20°C.

Method : If worms are preserved on DESS, transfer them in sterile deionised water. Repeat this two times to remove salts. Leave worms for ca 10 minutes in water to remove salts from the interior of the specimen. Distribute 2µl Prot K in sterile tubes of 0.5ml and keep them on ice. Bring one worm in 20 µl WLB on a sterile microscope slide and cut them in two (preferable more) pieces. Pipet the WLB with the worm pieces into a 0,5 ml tube. For large worms, use two tubes each containing 20µl WLB + pieces of anterior/posterior end of the specimen. Freeze 10' (or overnight) at -80°C => ice crystals brake cell walls incubate at 65 °C for 1 hour followed by 10 minutes at 95°C centrifuge 1 minute at maximum speed (14.000 rpm) use 1.5 µl for PCR.

Reaction mixture (Nematoda):

• 2.5 µl 10x PCR buffer (15mM MgCl2) (Qiagen)
• 2 µl MgCl2 (25mM) (Qiagen)
• 0.5 µl dNTP (10mM)
• 0.125 µl of each primer (25µM)
• 0.125µl TopTaq DNA polymerase (Qiagen
• 18.625 µl water

1 µl of template DNA is added to 24 µl of the mixture.

PCR mixtures are mixed, centrifuged and incubated in a preheated thermocycler.

Primers and cycling conditions (Nematoda):

• COI
  • Primers:
    • Forward: JB3 TTTTTTGGGCATCCTGAGGTTTAT
    • Reverse: JB5 AGCACCTAAACTTAAAACATAATGAAAATG
    • Forward: CO1490F GGTCAACAAATCATAAAGATATTGG
    • Reverse: CO2198R TAAACTTCAGGGTGACCAAAAAATCA
  • PCR conditions:
    • 94°C 5 min
    • 94°C 30 s
    • 54°C 30 s 35x
    • 72°C 30 s
    • 72°C 10 min
• ITS
  • Primers:
    • Forward: Vrain 2F CTT TGT ACA CAC CGC CCG TCG CT
    • Reverse: Vrain 2R TTT CAC TCG CCG TTA CTA AGG GAA TC
  • PCR conditions:
    • 94°C 5 min
    • 94°C 30 s
    • 56°C 30 s 35x
    • 72°C 45 s
    • 72°C 10 min
• D2D3
  • Primers:
    • Forward: D2A ACA AGT ACC GTG AGG GAA AGT TG
    • Reverse: D3B TCC TCG GAA GGA ACC AGC TAC TA
  • PCR conditions:
    • 94°C 5 min
    • 94°C 30 s
    • 54°C 30 s 35x
    • 72°C 45 s
    • 72°C 10 min

Top
List of Species

Current/planned Projects

2010

Taxonomy

Biology Of Selected Taxa

Mantha G, Hwang JS

Title: Abnormal protrusions on copepods from hydrothermal vent of Turtle Island, Taiwan.

Main funding: National Science Council, Taiwan.

Short description: Effects of Hydrothermal Vent plumes on zooplankton in Turtle island, Taiwan.

Tchesunov, AV

Title: Free-living nematodes of Mid Atlantic Ridge hydrothermal vents.

Main funding: Russian Fund of Fundamental Research.

Short description: Taxonomical descriptions and study of some biological traits (nutrition and reproduction) of free-living nematodes dwelling in rock crevices and mussel clusters of hydrothermal biotopes of North Mid Atlantic Ridge.

Taxonomy

Biology of Selected Taxa

Community Ecology

De Groote A, Derycke S, Vanreusel A

Title: Nematode connectivity between deep-sea cold seeps in the Eastern Mediterranean and the Gulf of Guinea.

Main funding: HERMIONE FP7 IP.

Short description: The nematode species Sabatieria mortenseni appears to be dominant in deep-sea cold seeps in the Eastern Mediterranean as in the Gulf of Guinea (Equatorial West-Africa). To investigate the possible connection between these different seeps, molecular analyses are performed in order to get deeper insights in the population genetics of this 'cosmopolitan' species.

Gollner S, Martínez Arbizu P, Fontaneto D

Title: Phylogeography of vent endemic dirivultid copepods: a first step into their hidden world.

Main funding: ChEss Mini-Grant to Sabine Gollner.

Short description: COI analyses of dirivultid copepods from deep-sea hydrothermal vents.

Van Campenhout J, Derycke S, Vanreusel A

Title: Analyses of gene expression, flexibility and adaptation of Halomonhystera disjuncta.

Main funding: ChEss Mini-Grant to Sabine Gollner .

Short description: Transcriptomic analyses of deep sea (Hakon mosby mud volcano) and estuarine (Westerschelde) Halomonhystera disjuncta.

Top
Biology Of Selected Taxa

Community Ecology

Interests Of Scientists

Barnes N, Glover A, Smith C, Ferrero T

Title: Diversity, dispersal and succession of whale-fall fauna in the deep sea.

Main funding: NHM Zoology Research Fund to Ferrero/Glover Smith & ChEss mini-grant to Barnes.

Short description: Ecological samples of infauna nematodes are studied over a distance from a whale carcass and over time. Principle aim to assess changes in the nematode species communities which may reflecting any disturbances or enrichment resulting from the presence of the carcass.

Bright M, Gollner S

Title: Meiovent succession: Succession of deep sea hydrothermal vent meiofauna after a recent eruption at the 9°50' N region of the East Pacific Rise.

Main funding: Austrian Science Foundation (FWF) project P20190-B17 to Monika Bright.

Short description: Meiofauna communities from various deep-sea hydrothermal vent habitats and in a time course from a few months to 4 years after a volcanic eruption are analyzed on species level.

Bright M, Degen R, Gollner S, Martínez Arbizu P, Nikolov N, Plum C, Riavitz LA

Title: Meiofauna diversity of tubeworm and mussel aggregations from deep-sea cold seeps in the Gulf of Mexico.

Main funding: Mineral Management Service Contract #1435-01-05-39187 to TDI-Brooks International .

Short description: Epifaunal meiofauna deep-sea seep communities are analyzed on genera level.

De Groote A, Vanreusel A

Title: Meiofauna of the Eastern Mediterranean deep-sea cold seep communities, with special emphasis on the nematode community structure.

Main funding: HERMIONE.

Short description: The densities of the meiofauna present in different cold seeps (brine lake, pockmarks, mud volcanoes) in the Eastern Mediterranean are assessed. Next to this, nematode genera were identified, both in reduced as in hemipelagic sediments to unravel the nematode community structure.

Gollner S, Martínez Arbizu P

Title: Multidisciplinary approach to unravel biogeography and diversity patterns of hydrothermal vent meiofauna in the Western Pacific.

Main funding: Alexander von Humboldt Foundation to Sabine Gollner.

Short description: Meiofauna communities associated with deep-sea hydrothermal vent mussel and snail aggregations are studied on species level. Some new species will be described. Molecular anlayses is carried out to gain insight into phylogeography.

Guilini K, Levin L, Vanreusel A

Title: Characterization of the nematode community in different microhabitats at Hydrate Ridge on the northeastern Pacific margin.

Main funding:

Short description: Hydrate Ridge, located on the Cascadia margin in the Pacific Ocean, is characterized by the presence of outcropping hydrates and methane venting cold seeps. The aim of this study is to analyse the meiofaunal community in relation to the environmental characteristics appearing at the different patchily distributed microhabitats of Beggiatoa and Thioploca microbial mats and Calyptogena clam beds on a northern, southern and eastern location of Hydrate Ridge. The nematode data will be combined with studies of the chemistry of the pore fluids and macrofaunal data to find out what factors structure the nematode communities. ¹³C values of the nematodes will also reveal the trophic relation between the nematodes and the chemosynthetic environment where carbon isotope values are typically highly depleted in ¹³C due to anaerobic oxidation of methane (AOM) associated with sulfate reduction.

Guilini K, Soltwedel T, Vanreusel A

Title: Nematode migration and colonisation in bacterial mats at the Håkon Mosby Mud Volcano.

Main funding: Flanders Fund for Scientific Research (FWO, project number 3G0346), the Special Research Fund (BOF, The relation between FUNction and biodiversity of nematoda in the DEEP-sea (FUNDEEP), project number 01J14909).

Short description: A small scale enrichment / colonization experiment was performed in situ at the Håkon Mosby Mud Volcano (HMMV, SW Barents Sea slope, 1280 m) during the R/V Polarstern ARK-XXII/1b campaign (June 23 - July 9, 2007). In this experiment, 13C-labelled diatoms were added to azoic sediments in cores that were inserted in a bacterial mat by means of ROV Quest. After 3 days the cores were recovered and nematodes were counted and analysed for 13C label uptake. The results give us more insight in the feeding ecology and mobility of the dominant nematode Halomonhystera disjuncta.

Hwang JS, Dahms HU

Title: The effects of hydrothermal vent on the marine life in Turtle Island.

Kuhnert J, Miljutin D, Miljutina M

Title: The investigation of nematode community of the mud volcano from the Anaximenes Seamount (Mediterranean).

Main funding: DFG

Short description: The composition and diversity of nematode assemblages will be studied and quantitatively analyzed at species level; nematode life forms will be analyzed and classified; some new nematode species will be described.

Lampadariou N, Kalogeropoulou V

Title: Meiobenthos at Amsterdam and Napoli mud volcanoes in the eastern Mediterranean.

Main funding: HERMIONE "Hotspot Ecosystem Research and Man's Impact on European Seas" (Framework 7 Collaborative Project; contract number 226354).

Short description: Meiofauna communities associated with different microhabitats, such as Lamellibrachia fields or mussel beds, at Amsterdam and Napoli mud volcanoes. Nematodes and harpacticoid copepods will be identified to species level.

Lee M

Title: Meiofauna of the Isla Mocha cold seep.

Funding: Fondo Nacional de Desarrollo Cientifico y Tecnologico (Fondecyt).

Short description: A study of the fauna associated with the intertidal cold seep on the island of Mocha, located of the coast of south-central Chile.

Lee M

Title: Latitudinal gradients in diversity, range-size and body-size of littoral free-living marine nematodes along the coast of Chile.

Funding: Fondo Nacional de Desarrollo Cientifico y Tecnologico (Fondecyt).

Short description: Sampling along the entire coast of Chile in order to study the macroecology of Nematoda, and other meiofauna.

Moodley L, Vanreusel A, Pape E

Title: Trophoecology of metazoan meiofauna in contrasting deep-sea environments including seeps. Application of bulk tissue and compound specific stable isotopes.

Funding: European Science Foundation.

Moodley L, Koho K

Title: Trophoecology of benthic foraminifera in the oxygen minimum zone in the Eastern Arabian Sea.

Funding: Dutch Science Foundation.

Moodley L, Hwang JS

Title: Fatty acid and stable isotope constraints on the trophoecology of a hydrothermal vent thriving crab Xenograpsus testudinatus.

Funding: Local department funding.

Pape E, Bezerra TN, Vanneste H, Heeschen K, Moodley L, Van Breugel P, Vanreusel A

Title: Small-scale spatial heterogeneity of structural and trophic diversity of meiofauna associated with methane seepage at the Darwin mud volcano (Gulf of Cádiz).

Main funding: HERMIONE

Short description: The variation in community structure and feeding behavior of meiofauna (emphasis on nematodes) in relation to the distance from a seeping sediment spot on the Darwin mud volcano is investigated.

Pape E, Bezerra TN, Vanneste H, Heeschen K, Moodley L, Van Breugel P, Vanreusel A

Title: Small-scale spatial heterogeneity of structural and trophic diversity of meiofauna associated with methane seepage at the Darwin mud volcano (Gulf of Cádiz).

Main funding: HERMIONE

Short description: The variation in community structure and feeding behavior of meiofauna (emphasis on nematodes) in relation to the distance from a seeping sediment spot on the Darwin mud volcano is investigated.

Sarrazin J, De Busserolles F, Guilini K,Vanreusel A, Ivanenko V , Arnaud-Haond S, Briand P, Fabri MC, Gauthier O, Legendre P, Sarradin PM

Title: Meiofaunal assemblages in contrasted habitats on Tour Eiffel hydrothermal edifice, MAR.

Main funding: ANR DEEP OASES, MARBEF

Short description: Hydrothermal vent systems are characterized by differing faunal compositions, with variations in density, diversity and dominant species, depending on the geographic location and intrinsic abiotic factors. On the Tour Eiffel hydrothermal edifice twelve microhabitats colonized by the bivalve Bathymodiolus azoricus were studied in order to elucidate meiofaunal-habitat relationships. The aim of this study was to gain an integrated view on the structuring effect of several abiotic factors (temperature, pH, total dissolved sulfide, iron and copper concentrations) on the meiofaunal community structure, with emphasis on the most abundant groups (nematodes, copepods) and to elucidate the role of the two dominant nematode genus by means of stable isotope (13C/15N) analyses.

Schewe I, Guilini K, Klages M, Sachs O, Sauter E, Soltwedel T

Title: The fate of large nekton carcasses at two Arctic deep sea ecosystems: a comparative study of the impact on benthic infauna..

Main funding: Funding by Alfred-Wegener-Institute.

Short description: Two sagitally sectioned whale carcasses (porpoise, Phocoena phocoena) were deployed at 2500m (mid slope depth) and 5500m (abyssal Molloy Deep) water-depth at the Arctic HAUSGARTEN site to allow comparisons of the changes in two totally different deep-sea habitats as a reaction on the food input. The observation by time-lapse camera-systems, mounted on lander systems, allowed detailed monitoring of food consumption speed and of the epibenthic scavengers itself. After almost three weeks of deployment, we revisited the experimental setups with the remotely operated vehicle VICTOR 6000 and performed an extensive targeted sediment-sampling. Attention was especially given to the different community reactions of the smallest benthic organisms on the deployed both food-falls at mid slope depths (2500m) and at Arctic's abyssal Molloy Deep (5500m).

Top
Community Ecology

Interests of Scientists/Material Searched

Public Outreach Experience

Barnes, N

Taxonomically I am interested in nematodes, all marine groups, and have described Leptolaimidae from shallow intertidal environments. I have undertaken ecological studies of free-living nematodes in most marine habitats, and specifically whale falls in deep sea chemosynthetic environments.

De Groote, A

Mainly interested in the meiofauna (nematode) ecology from chemosynthetic environments (cold seeps), molecular tools that can be used to identify nematode (population) genetic structures.

Looking for possible new (better) genetic markers to unravel nematode population genetic structure.

Ferrero, T

I am interested in all aspects of marine free-living nematode taxonomy and ecology. In the deep sea, I am involved in projects looking at whale fall meiofauna, the fauna associated with hydrothermal seeps and cold seeps and also the role of organic input and seasonality in the deep sea and Antarctic shelf/deep sea.

Gollner, S

Mainly interested in the ecology of deep-sea hydrothermal vents.Looking for copepod material for DNA analyses (primarily Dirivultidae in 99 % EtOH).

Guilini, K

Mainly interested in the ecology and community composition of deep-sea nematodes at different habitats (seeps, vents, abyssal plains, whale falls). Currently not looking for material, but always interested in working together, sharing ideas or giving advice.

Ivanova, K

Interests - ecology of methane seeps communities, also other reducing environment communities; taxonomy of Nematoda.

Kalogeropoulou, V

Mainly interested in spatial and temporal patterns of meiobenthic communities. Taxonomy of harpacticoid copepods.

Lampadariou, N

Mainly interested in distribution patterns and community ecology of nematodes. Adaptations of meiofauna and particularly nematodes to extreme environmental conditions.

Lee, M

Biodiversity of meiofauna.

Miljutina, M; Miljutin, D

Taxonomical interests - Nematoda, Families: Microlaimidae, Richtersiidae, Benthimermithidae, Rhaptothireidae; Genus: Acantholaimus.

Moodley, L

Interested primarily in comparison of metazoan meiofauan with foraminifera, their ecological adaptation strategies across ecosystems, especially extreme environments.

Plum, C

Interested in community ecology of (harpacticoid) copepods from cold seeps and hydrothermal vents. Taxonomical interests: copepods Looking for cooperation in ecological stoichiometry, fatty acid and stable isotop analyses of cold seep meiofauna.

Portnova, D

Taxonomical interests - Nematoda (especially families: Comesomatidae, Linhomoidae), Tardigrada. Ecological interests: meiofauna from fresh water mud volcano or any freshwater reduced environments; small scale distribution of nematodes at species level from different habitats (for example: bacterial mats, pogonophora fields) of seeps, pockmarks.

Tchesunov, AV

Taxonomical interests - free-living nematodes from deep-sea hydrothermal vents worldwide.

Top
Interests of Scientists/Material Searched

Public Outreach Experience

Barnes, N

I have occasionally supported Natural History Museum: Nature Live http://www.nhm.ac.uk/visit-us/whats-on/daily-events/nature-live/index.html with Tim Ferrero. I also take part in outside events such as the OPAL bioblitz http://www.opalexplorenature.org/WemburyBioblitzPhotos.

Bright, M (Gollner, S)

Science day: guiding school kids and adults through a program where people can experience various themes that are important for deep-sea hydrothermal vent research (i.e. large puzzle for plate tectonics, smelling sulfide, experiencing high pressure and what is does to different materials such as styrofoam or wood, watching bacteria through microscopes, building hydrothermal vent food chains).

Bright, M (Gollner, S)

Extreme for kids: school kids learn about deep-sea hydrothermal vents, ask questions about science and ship life, perform experiments, make a call to the deep. For further details see homepage of Monika Bright www.hydrothermalvent.com

Bright, M

Seakip: School kids do participative learning and learn how to develop scientific projects. For further details see homepage of Monika Bright www.hydrothermalvent.com.

Ferrero, T

Natural History Museum: Nature Live http://www.nhm.ac.uk/visit-us/whats-on/daily-events/nature-live/index.html. I regularly contribute to this continuous program of public events, which take place every day in the NHM. My events cover a range of marine topics, almost always including aspects of the ecology and taxonomy of marine free-living nematodes, often with reference to the deep sea. Particularly popular is a demonstration where I show the audience the extraction of a live meiofauna sample and then show them the living animals under a video microscope.

I also take part in outside events (e.g. Lyme Regis Fossil Festival - http://www.fossilfestival.com/science) and public lectures and have just completed a 2yr "Science in Society" project funded under the E.U. Framework 7 (4SEAS - www.4seas.eu).

Guilini, K (Vanreusel, A)

Writing a (dutch) blog on the website of the Flanders Marine Insitute (www.vliz.be) while onboard of the RV Polarstern on an expedition to the Håkon Mosby Mud Volcano and the Hausgarten site. As such, readers could get a feeling of life on board and the purpose of this expedition. The blog was almost daily updated with info on the gear used for sampling, the experiments performed by the ROV Quest, etc.

Guilini, K; Ingels, J; Vanreusel, A

European Night of the Researchers, Bozar, Brussels, Belgium ( http://www.nachtvandeonderzoekers.be/). By means of posters, video images and a small toy ROV, visitors are introduced to the different habitats found in the deep-sea and can experience how biological science is done at great depths.

Hwang, JS

Making DVD of the shallow water hydrothermal vent ecosystem of Taiwan in three languages (Chinese, English and Japanese, totally 18 minutes) for tourism bureau ministry of transportation and communication of Taiwan.

Lampadariou, N; Kalogeropoulou, V

Participation in exhibitions and public outreach activities for the European Day of the Sea at HCMR.

Lee, M

Participation in the Programa Explora, includes production of posters (e.g. "Los habitantes de Castillos de Arena" ("The sandcastles' inhabitants") and "Macroecología: Patrones en diversidad sobre la grande escala" ("Macroecology: Large Scale Patterns of Diversity")); open laboratory days and small scale research projects with school children.

Miljutina, M; Miljutin, D; Plum, C

European Day of the Sea, Long Museum's Night: Participation in the organization of different exhibitions, showing the research and service activity of Senckenberg Institute (European Day of the Sea, Long Museum's Night).

Marine Biology Research Group (Vanreusel, A; Guilini, K; Bezerra, TN; Pape, E amongst others)

"Ugent aan Zee" (translation: "Ugent at sea"): presentation of research activities to the larger public.

Portnova, D

Sessions on diving boats. People travel with dive leader (me) to different countries; dives and hearing or learning sea ecology, hydrothermal and seep ecology aspects and fauna, watching plankton, corals, sand with meiobenthos undera stereo-microscope.

Kids biological school at the White Sea: Kids and teenagers dive and collect material for microscope watching. They prepare an aquarium with fauna of White Sea, draw big sea animals, investigate the morphology, and do self-guided ecology work.